|
Left Crispr |
Right Crispr |
Crispr ID |
1138546659 |
1138546661 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:57723453-57723475
|
16:57723471-57723493
|
Sequence |
CCGGACACAGGGGCTCACACCTG |
ACCTGTAATCCAAGCGCTTTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 425, 2: 7639, 3: 30616, 4: 78434} |
{0: 2, 1: 1413, 2: 85899, 3: 329778, 4: 267375} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|