|
Left Crispr |
Right Crispr |
| Crispr ID |
1138546659 |
1138546666 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:57723453-57723475
|
16:57723484-57723506
|
| Sequence |
CCGGACACAGGGGCTCACACCTG |
GCGCTTTGGGAGGCCAACATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 425, 2: 7639, 3: 30616, 4: 78434} |
{0: 3, 1: 141, 2: 3632, 3: 44946, 4: 156098} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|