ID: 1138699487_1138699502

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1138699487 1138699502
Species Human (GRCh38) Human (GRCh38)
Location 16:58847005-58847027 16:58847047-58847069
Sequence CCAGCTTCGGCTCCGCATGAGAG GCAGAGGGAGAGGAGGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 101, 2: 149, 3: 672, 4: 3822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!