ID: 1139508993_1139508998

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1139508993 1139508998
Species Human (GRCh38) Human (GRCh38)
Location 16:67415854-67415876 16:67415893-67415915
Sequence CCTGAAATCACTTTAGTCATGTA GCCCCCTTCCTTAATGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 192} {0: 1, 1: 0, 2: 2, 3: 10, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!