|
Left Crispr |
Right Crispr |
| Crispr ID |
1139587420 |
1139587427 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:67913042-67913064
|
16:67913070-67913092
|
| Sequence |
CCAGGTGTGGGCACATGCCTGTA |
AGCTACTCAGGAGGCTGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 4, 2: 27, 3: 182, 4: 682} |
{0: 12796, 1: 27138, 2: 40269, 3: 37422, 4: 31273} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|