ID: 1139752978_1139752984

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1139752978 1139752984
Species Human (GRCh38) Human (GRCh38)
Location 16:69120329-69120351 16:69120352-69120374
Sequence CCTGTGGTCCCAGGGAACCGTCG AGCCGTCCTCGAGGTGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85} {0: 1, 1: 0, 2: 2, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!