ID: 1140046492_1140046500

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1140046492 1140046500
Species Human (GRCh38) Human (GRCh38)
Location 16:71443190-71443212 16:71443215-71443237
Sequence CCCTATGCTGACCAGGAGCCTGA CTGAGAGGCCCAGGGTCACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!