|
Left Crispr |
Right Crispr |
| Crispr ID |
1140602912 |
1140602913 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:76500035-76500057
|
16:76500049-76500071
|
| Sequence |
CCATCGTCATCATGGCCCGTTCT |
GCCCGTTCTCAATGAGCTGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 414, 1: 1018, 2: 754, 3: 186, 4: 228} |
{0: 1290, 1: 604, 2: 139, 3: 40, 4: 84} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|