ID: 1140602912_1140602925

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1140602912 1140602925
Species Human (GRCh38) Human (GRCh38)
Location 16:76500035-76500057 16:76500079-76500101
Sequence CCATCGTCATCATGGCCCGTTCT TCCCTGACGGGGTGGCGGCGGGG
Strand - +
Off-target summary {0: 414, 1: 1018, 2: 754, 3: 186, 4: 228} {0: 1, 1: 48, 2: 1548, 3: 4235, 4: 4290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!