ID: 1140700259_1140700272

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1140700259 1140700272
Species Human (GRCh38) Human (GRCh38)
Location 16:77575044-77575066 16:77575082-77575104
Sequence CCTCTCATCTCCCCACGGTGCTC ATCCTGGAGGGGACCTGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239} {0: 1, 1: 0, 2: 3, 3: 26, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!