ID: 1140700262_1140700275

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1140700262 1140700275
Species Human (GRCh38) Human (GRCh38)
Location 16:77575055-77575077 16:77575089-77575111
Sequence CCCACGGTGCTCAGACGGCCCAG AGGGGACCTGCCAAGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!