|
Left Crispr |
Right Crispr |
| Crispr ID |
1141350178 |
1141350184 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:83287401-83287423
|
16:83287454-83287476
|
| Sequence |
CCAAGCTTCATCTGTATTTACAG |
GCTCCACCTCCTGTCAGATCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10, 1: 17, 2: 13, 3: 26, 4: 254} |
{0: 11, 1: 29, 2: 39, 3: 45, 4: 141} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|