ID: 1141559542_1141559545

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1141559542 1141559545
Species Human (GRCh38) Human (GRCh38)
Location 16:84858027-84858049 16:84858061-84858083
Sequence CCAGTAACAGGCCAAGAGCTGTC AAGTAGTTATCTGCAGAAGATGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} {0: 8, 1: 205, 2: 192, 3: 111, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!