ID: 1141559542_1141559546

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1141559542 1141559546
Species Human (GRCh38) Human (GRCh38)
Location 16:84858027-84858049 16:84858065-84858087
Sequence CCAGTAACAGGCCAAGAGCTGTC AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 162, 1: 189, 2: 129, 3: 114, 4: 178} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!