ID: 1141665390_1141665409

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1141665390 1141665409
Species Human (GRCh38) Human (GRCh38)
Location 16:85462957-85462979 16:85463001-85463023
Sequence CCCCCGCCCCCTCCGGGCCCGTC CTACTGCTCGCCTCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 99, 4: 780} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!