ID: 1141883523_1141883528

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1141883523 1141883528
Species Human (GRCh38) Human (GRCh38)
Location 16:86875584-86875606 16:86875635-86875657
Sequence CCGTCTTAGGAAAAAATGAAATA GATGTTTTCTTCATCCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 157, 4: 2198} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!