ID: 1141972424_1141972444

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1141972424 1141972444
Species Human (GRCh38) Human (GRCh38)
Location 16:87492691-87492713 16:87492736-87492758
Sequence CCGCCCCGGCCATGCCGTCGCCG CGGCCGTTACCCCGGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 153} {0: 1, 1: 1, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!