ID: 1141972426_1141972443

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1141972426 1141972443
Species Human (GRCh38) Human (GRCh38)
Location 16:87492695-87492717 16:87492735-87492757
Sequence CCCGGCCATGCCGTCGCCGCCGC CCGGCCGTTACCCCGGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 53, 4: 326} {0: 1, 1: 1, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!