ID: 1141972429_1141972444

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141972429 1141972444
Species Human (GRCh38) Human (GRCh38)
Location 16:87492705-87492727 16:87492736-87492758
Sequence CCGTCGCCGCCGCCCGCGCCTCC CGGCCGTTACCCCGGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 38, 3: 289, 4: 2831} {0: 1, 1: 1, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!