ID: 1141972439_1141972455

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1141972439 1141972455
Species Human (GRCh38) Human (GRCh38)
Location 16:87492729-87492751 16:87492765-87492787
Sequence CCCAGGCCGGCCGTTACCCCGGG GTCGCCGCCTGGGGAGCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 66} {0: 1, 1: 0, 2: 2, 3: 11, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!