ID: 1141972448_1141972467

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1141972448 1141972467
Species Human (GRCh38) Human (GRCh38)
Location 16:87492746-87492768 16:87492796-87492818
Sequence CCCGGGCCGCGGGCGCGGCGTCG CCGCGAAACGGACGCTGGAGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 36, 4: 350} {0: 1, 1: 0, 2: 1, 3: 0, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!