ID: 1141972450_1141972465

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1141972450 1141972465
Species Human (GRCh38) Human (GRCh38)
Location 16:87492752-87492774 16:87492795-87492817
Sequence CCGCGGGCGCGGCGTCGCCGCCT GCCGCGAAACGGACGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 219} {0: 1, 1: 0, 2: 1, 3: 2, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!