ID: 1141972458_1141972469

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141972458 1141972469
Species Human (GRCh38) Human (GRCh38)
Location 16:87492769-87492791 16:87492800-87492822
Sequence CCGCCTGGGGAGCGCTGGGGGCC GAAACGGACGCTGGAGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 332} {0: 1, 1: 0, 2: 1, 3: 19, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!