ID: 1141972462_1141972474

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141972462 1141972474
Species Human (GRCh38) Human (GRCh38)
Location 16:87492790-87492812 16:87492816-87492838
Sequence CCGCGGCCGCGAAACGGACGCTG GGGGAGGGACGCGCGGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 31} {0: 1, 1: 0, 2: 9, 3: 99, 4: 788}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!