ID: 1142009011_1142009025

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142009011 1142009025
Species Human (GRCh38) Human (GRCh38)
Location 16:87704369-87704391 16:87704411-87704433
Sequence CCTGGGGAGGGTCCTGAACATGA GGAGGGTCCTGAACGTCACGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 14, 4: 167} {0: 3, 1: 0, 2: 2, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!