ID: 1142009015_1142009025

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1142009015 1142009025
Species Human (GRCh38) Human (GRCh38)
Location 16:87704381-87704403 16:87704411-87704433
Sequence CCTGAACATGACAGGGAAGGAGG GGAGGGTCCTGAACGTCACGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 34, 4: 276} {0: 3, 1: 0, 2: 2, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!