ID: 1142123018_1142123025

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1142123018 1142123025
Species Human (GRCh38) Human (GRCh38)
Location 16:88396550-88396572 16:88396573-88396595
Sequence CCTCCTGAAGGGAGGCCAGATGG AGACCCTCCTGAAGGGAGGCCGG
Strand - +
Off-target summary No data {0: 8, 1: 4, 2: 6, 3: 20, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!