ID: 1142123065_1142123070

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142123065 1142123070
Species Human (GRCh38) Human (GRCh38)
Location 16:88396685-88396707 16:88396704-88396726
Sequence CCGTCTGAAGGGAGGCCAGATGG ATGGAAACCCTCCTGAAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 22, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!