ID: 1142190449_1142190465

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142190449 1142190465
Species Human (GRCh38) Human (GRCh38)
Location 16:88714905-88714927 16:88714953-88714975
Sequence CCGCGTGAACATGAAGGACTTGG CCGGGCTTGGGGACGCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 77} {0: 1, 1: 0, 2: 3, 3: 17, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!