ID: 1142190455_1142190465

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1142190455 1142190465
Species Human (GRCh38) Human (GRCh38)
Location 16:88714938-88714960 16:88714953-88714975
Sequence CCCACCTGTCCTGGGCCGGGCTT CCGGGCTTGGGGACGCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 155} {0: 1, 1: 0, 2: 3, 3: 17, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!