ID: 1142190455_1142190476

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1142190455 1142190476
Species Human (GRCh38) Human (GRCh38)
Location 16:88714938-88714960 16:88714991-88715013
Sequence CCCACCTGTCCTGGGCCGGGCTT TGGCTTGAGGGGGTGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 155} {0: 1, 1: 1, 2: 2, 3: 16, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!