ID: 1142190459_1142190472

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142190459 1142190472
Species Human (GRCh38) Human (GRCh38)
Location 16:88714942-88714964 16:88714980-88715002
Sequence CCTGTCCTGGGCCGGGCTTGGGG CACCTCGTGGGTGGCTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 439} {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!