|
Left Crispr |
Right Crispr |
| Crispr ID |
1142278313 |
1142278320 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:89134463-89134485
|
16:89134499-89134521
|
| Sequence |
CCGGAGGAATAGAAGTCAGCGGC |
CGGCAAGCAGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 30, 3: 103, 4: 191} |
{0: 1, 1: 70, 2: 134, 3: 86, 4: 240} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|