ID: 1142428592_1142428607

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142428592 1142428607
Species Human (GRCh38) Human (GRCh38)
Location 16:90013794-90013816 16:90013843-90013865
Sequence CCTTCTGAGGGACGGCCAGTGCC ATTTTAGGGGGCATCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128} {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!