ID: 1142496625_1142496633

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1142496625 1142496633
Species Human (GRCh38) Human (GRCh38)
Location 17:309611-309633 17:309638-309660
Sequence CCAGGATATGGCACATCCCCCGT GGCTCCTGCCAGCCCCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 43} {0: 2, 1: 2, 2: 7, 3: 73, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!