|
Left Crispr |
Right Crispr |
Crispr ID |
1142508768 |
1142508777 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:381392-381414
|
17:381410-381432
|
Sequence |
CCCCCCACATCCCTCCCGGAAGC |
GAAGCCCTCCTCATGCTTCCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 10, 2: 62, 3: 5132, 4: 3008} |
{0: 7, 1: 5, 2: 18, 3: 35, 4: 250} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|