|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528868 |
1142528879 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565228-565250
|
17:565279-565301
|
| Sequence |
CCCGTCTTCACTAAAAACACAAA |
TGTAATCCCAGCTACTCGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 540, 2: 16512, 3: 191682, 4: 213241} |
{0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|