ID: 1142541165_1142541177

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142541165 1142541177
Species Human (GRCh38) Human (GRCh38)
Location 17:660632-660654 17:660675-660697
Sequence CCTTGGGGAAGGACGAGGGCCCC GCATCCTTGGTGAAGGACGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 219} {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!