ID: 1142591206_1142591218

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142591206 1142591218
Species Human (GRCh38) Human (GRCh38)
Location 17:1006868-1006890 17:1006902-1006924
Sequence CCTCCGCCAGCCACGGGCCCGGG TACCTGCGCCATGACGTCATGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529} {0: 6, 1: 1, 2: 0, 3: 0, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!