ID: 1142591286_1142591297

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142591286 1142591297
Species Human (GRCh38) Human (GRCh38)
Location 17:1007128-1007150 17:1007161-1007183
Sequence CCTCCGCCAGCCACGGGCCCGGG GTACCTGCGCCATGACGTCATGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 31, 4: 529} {0: 6, 1: 1, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!