ID: 1142618055_1142618065

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142618055 1142618065
Species Human (GRCh38) Human (GRCh38)
Location 17:1148065-1148087 17:1148114-1148136
Sequence CCCACCCCACGGTAAGCTTCAAG AAGTAAGCCCAAAGGTTGTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 109} {0: 1, 1: 0, 2: 2, 3: 10, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!