ID: 1142631706_1142631716

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142631706 1142631716
Species Human (GRCh38) Human (GRCh38)
Location 17:1229831-1229853 17:1229850-1229872
Sequence CCACAGCCAGCTCGGGCCGCGGA CGGAGCCGCCGGGGGAGGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 61, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!