ID: 1142799724_1142799728

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1142799724 1142799728
Species Human (GRCh38) Human (GRCh38)
Location 17:2337596-2337618 17:2337613-2337635
Sequence CCGCCTTGCGCGTGGGGCGCTGA CGCTGAGCCGAGAGGCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!