ID: 1142866465_1142866476

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142866465 1142866476
Species Human (GRCh38) Human (GRCh38)
Location 17:2794497-2794519 17:2794528-2794550
Sequence CCACCCCAGAGCATGAACCACAC CTTTCCTGGGGCAGAGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160} {0: 1, 1: 0, 2: 1, 3: 51, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!