ID: 1142866466_1142866481

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142866466 1142866481
Species Human (GRCh38) Human (GRCh38)
Location 17:2794500-2794522 17:2794535-2794557
Sequence CCCCAGAGCATGAACCACACAAT GGGGCAGAGGTGAGGGTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145} {0: 1, 1: 1, 2: 18, 3: 164, 4: 1348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!