ID: 1142866477_1142866485

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1142866477 1142866485
Species Human (GRCh38) Human (GRCh38)
Location 17:2794532-2794554 17:2794557-2794579
Sequence CCTGGGGCAGAGGTGAGGGTTGG GAAGCCTCCGGGCTCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 76, 4: 608} {0: 1, 1: 0, 2: 2, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!