ID: 1142888898_1142888918

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1142888898 1142888918
Species Human (GRCh38) Human (GRCh38)
Location 17:2930235-2930257 17:2930280-2930302
Sequence CCAGGCCCCCTTGTGGCCAATAC GTGGCTGGGGCTGGGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 82} {0: 1, 1: 1, 2: 18, 3: 159, 4: 1470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!