ID: 1142888899_1142888910

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1142888899 1142888910
Species Human (GRCh38) Human (GRCh38)
Location 17:2930240-2930262 17:2930266-2930288
Sequence CCCCCTTGTGGCCAATACCATCA CCACGTGGGAGCCTGTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 123} {0: 1, 1: 0, 2: 1, 3: 30, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!