ID: 1142888900_1142888914

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142888900 1142888914
Species Human (GRCh38) Human (GRCh38)
Location 17:2930241-2930263 17:2930273-2930295
Sequence CCCCTTGTGGCCAATACCATCAG GGAGCCTGTGGCTGGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83} {0: 1, 1: 1, 2: 17, 3: 243, 4: 1714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!