ID: 1142888900_1142888917

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1142888900 1142888917
Species Human (GRCh38) Human (GRCh38)
Location 17:2930241-2930263 17:2930279-2930301
Sequence CCCCTTGTGGCCAATACCATCAG TGTGGCTGGGGCTGGGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83} {0: 1, 1: 0, 2: 26, 3: 431, 4: 2031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!